View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_57 (Length: 255)
Name: NF19445_high_57
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 26 - 239
Target Start/End: Original strand, 5763312 - 5763525
Alignment:
| Q |
26 |
tgatgaacatgaaagagataacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaacattgatgatcattggc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5763312 |
tgatgaacatgaaagagataacaaagccaaccagaaagtttcattccacaaactctttacttttgctgatagtcttgatgtaacattgatgatcattggc |
5763411 |
T |
 |
| Q |
126 |
accatctctgccgttgctaatggtatgatacagcctatcatgactctcattcttggcaaaatcatcaatacctttggctcaacagatcctcaccacatag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5763412 |
accatctctgccgttgctaatggtatgacacagcctatcatgactctcattcttggcaaaatcatcaatacctttggctcaatagatcctcaccacatag |
5763511 |
T |
 |
| Q |
226 |
tcaaagaagtttct |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5763512 |
tcaaagaagtttct |
5763525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 148
Target Start/End: Complemental strand, 5835375 - 5835266
Alignment:
| Q |
39 |
agagataacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaacattgatgatcattggcaccatctctgccg |
138 |
Q |
| |
|
|||||||||||| | || || |||||| ||||| ||| || |||| |||||||||| |||||||||||| ||||||||||||||||| |||||||| | |
|
|
| T |
5835375 |
agagataacaaaacaaaacaaaaagttccattctacatgcttttcaattttgctgatcatcttgatgtaacgttgatgatcattggcactatctctgctg |
5835276 |
T |
 |
| Q |
139 |
ttgctaatgg |
148 |
Q |
| |
|
| |||||||| |
|
|
| T |
5835275 |
tggctaatgg |
5835266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 44 - 148
Target Start/End: Complemental strand, 29332842 - 29332738
Alignment:
| Q |
44 |
taacaaagccaaccagaaagtttcattccacaaactcttcacttttgctgatagtcttgatgtaacattgatgatcattggcaccatctctgccgttgct |
143 |
Q |
| |
|
||||||||||||||| | |||| ||||| |||| ||||| | |||||||||| ||||||| ||||| ||||||||||||||||| || |||||| | ||| |
|
|
| T |
29332842 |
taacaaagccaaccaaatagttccattctacaagctctttagttttgctgatcgtcttgacgtaactttgatgatcattggcactatttctgccatggct |
29332743 |
T |
 |
| Q |
144 |
aatgg |
148 |
Q |
| |
|
||||| |
|
|
| T |
29332742 |
aatgg |
29332738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University