View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_61 (Length: 250)
Name: NF19445_high_61
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 128 - 243
Target Start/End: Original strand, 52218628 - 52218743
Alignment:
| Q |
128 |
gtatacacttcatcaatcataattgttatatcaatcaaaatatttgattttaactatatttgctttattttaaaattatataaatgagatgagattatga |
227 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52218628 |
gtatacacttcatcaatcataatcgttatatcaatcaaaatatttgattttaactatatttgctttattttaaaattatataaatgagatgagattatga |
52218727 |
T |
 |
| Q |
228 |
tctaatgtctatggag |
243 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52218728 |
tctaatgtctatggag |
52218743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 11 - 112
Target Start/End: Original strand, 52218467 - 52218568
Alignment:
| Q |
11 |
agaatatacacccctccatattcaagtatataacgagaaaaatgtgaaataagttatgagatacttttcaaagatactatatctttatgtttaattttga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52218467 |
agaaaatacacccctccatattcaagtatataacgagaaaaatgtgaaataaattatgagatacttttcaaagatactatatctttatgtttaattttga |
52218566 |
T |
 |
| Q |
111 |
tg |
112 |
Q |
| |
|
|| |
|
|
| T |
52218567 |
tg |
52218568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University