View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_high_72 (Length: 210)
Name: NF19445_high_72
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_high_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 823724 - 823541
Alignment:
| Q |
20 |
gaggggggttatatgtatttgatttaagagaagtgctattccccagcacaaaaaatgtctcgagcatttcacgaggcgtgtgcaccgttggatcttgatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
823724 |
gaggggggttatatgtatttgatttaagagaagtgctattccccggcacaaaaaatgtctcgagcatttcatgaggcgtgtgcaccgttggatcttggtt |
823625 |
T |
|
| Q |
120 |
ttaattccggtttaagtggaaaacatggtggtcatggtataacagccaatcacaac-aattcgctaccctttcttgagaataat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
823624 |
ttaattccggtttaagtggaaaacatggtggtcatggtataacagccaaccacaacaaattcgctaccctttcttgagaataat |
823541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 67 - 116
Target Start/End: Complemental strand, 2287731 - 2287682
Alignment:
| Q |
67 |
acaaaaaatgtctcgagcatttcacgaggcgtgtgcaccgttggatcttg |
116 |
Q |
| |
|
|||||||||||| ||| |||||||||| || |||||||| |||||||||| |
|
|
| T |
2287731 |
acaaaaaatgtcccgatcatttcacgaagcttgtgcacccttggatcttg |
2287682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University