View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19445_low_2 (Length: 760)

Name: NF19445_low_2
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19445_low_2
NF19445_low_2
[»] chr4 (3 HSPs)
chr4 (102-202)||(6275434-6275528)
chr4 (13-74)||(6275545-6275606)
chr4 (699-760)||(6274907-6274968)


Alignment Details
Target: chr4 (Bit Score: 54; Significance: 1e-21; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 202
Target Start/End: Complemental strand, 6275528 - 6275434
Alignment:
102 atcaaatctgaagactttaatattcaaaagacttgaactaattcaagaatggttttagctagataatcaatccaacagttcgaagatgcagatttcaaac 201  Q
    |||||||||||| |||||||| |||||      ||||| ||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||    
6275528 atcaaatctgaatactttaattttcaa------tgaaccaattcaaaaatggttttagctagataatcaatccaacagctcaaagatgcagatttcaaac 6275435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 6275606 - 6275545
Alignment:
13 aacctgtggaacttgccggctttagagtgttgaaaataaaaagctttcaatattttaaaatg 74  Q
    ||||||| |||||||||||||||||||||||||||||| |||||||||||||  ||||||||    
6275606 aacctgtagaacttgccggctttagagtgttgaaaatagaaagctttcaataggttaaaatg 6275545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 699 - 760
Target Start/End: Complemental strand, 6274968 - 6274907
Alignment:
699 gtttttaccttgttaatcaatcattaccgttcaatgatcattagaaaagatcgattttcctc 760  Q
    |||||||| ||||||| |||||||| | |||| |||||||||||||||||||||||||||||    
6274968 gtttttacgttgttaaccaatcatttctgttcgatgatcattagaaaagatcgattttcctc 6274907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University