View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_2 (Length: 760)
Name: NF19445_low_2
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 1e-21; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 102 - 202
Target Start/End: Complemental strand, 6275528 - 6275434
Alignment:
| Q |
102 |
atcaaatctgaagactttaatattcaaaagacttgaactaattcaagaatggttttagctagataatcaatccaacagttcgaagatgcagatttcaaac |
201 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||| ||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
6275528 |
atcaaatctgaatactttaattttcaa------tgaaccaattcaaaaatggttttagctagataatcaatccaacagctcaaagatgcagatttcaaac |
6275435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 6275606 - 6275545
Alignment:
| Q |
13 |
aacctgtggaacttgccggctttagagtgttgaaaataaaaagctttcaatattttaaaatg |
74 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
6275606 |
aacctgtagaacttgccggctttagagtgttgaaaatagaaagctttcaataggttaaaatg |
6275545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 699 - 760
Target Start/End: Complemental strand, 6274968 - 6274907
Alignment:
| Q |
699 |
gtttttaccttgttaatcaatcattaccgttcaatgatcattagaaaagatcgattttcctc |
760 |
Q |
| |
|
|||||||| ||||||| |||||||| | |||| ||||||||||||||||||||||||||||| |
|
|
| T |
6274968 |
gtttttacgttgttaaccaatcatttctgttcgatgatcattagaaaagatcgattttcctc |
6274907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University