View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_21 (Length: 444)
Name: NF19445_low_21
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_21 |
 | |
|
| [»] scaffold0568 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 45629307 - 45629544
Alignment:
| Q |
13 |
aatataaattagaatttatgttagaatgcagtagctttgagttttcagatactttatatgtcattccaattgaatgtttaatggaatgtgctgctattat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45629307 |
aatataaattagaatttatgttagaatgcagtagctttgagttttcaggtactttatatgtcattccaattgaat---taatggaatgtgctgctattat |
45629403 |
T |
|
| Q |
113 |
cacattcaagaaaatatggggagtatttaattgagctggaaacagactcttttcgtagacatatgtttgaggcttgggtatgccttgaaaatttgcggtg |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45629404 |
cacattcaagaaaatatggggggtatttaattgagctggaaacaggctcttttcggagacatatgtttgaggcttgggtatgccttgaaaatttgcggtg |
45629503 |
T |
|
| Q |
213 |
atctgttgcaggtttgggcaggagggtatat-gcagcctca |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45629504 |
atctgttgcaggtttgggcaggagggtatatggcagcctca |
45629544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0568 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0568
Description:
Target: scaffold0568; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 252
Target Start/End: Complemental strand, 318 - 85
Alignment:
| Q |
17 |
taaattagaatttatgttagaatgcagtagctttgagttttcagatactttatatgtcattccaattgaatgtttaatggaatgtgctgctattatcaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
318 |
taaattagaatttatgttagaatgcagtagctttgagttttcaggtactttatatgtcattccaattgaat---taatggaatgtgctgctattatcaca |
222 |
T |
|
| Q |
117 |
ttcaagaaaatatggggagtatttaattgagctggaaacagactcttttcgtagacatatgtttgaggcttgggtatgccttgaaaatttgcggtgatct |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
221 |
ttcaagaaaatatggggggtatttaattgagctggaaacaggctcttttcggagacatatgtttgaggcttgggtatgccttgaaaatttgcggtgatct |
122 |
T |
|
| Q |
217 |
gttgcaggtttgggcaggagggtatat-gcagcctca |
252 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
121 |
gttgcaggtttgggcaggagggtatatggcagcctca |
85 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University