View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_34 (Length: 367)
Name: NF19445_low_34
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 2e-96; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 129 - 358
Target Start/End: Complemental strand, 3854525 - 3854298
Alignment:
| Q |
129 |
ttattagttttagcatgctcagagtttctgttgctgaatgattctagcatgctactagnnnnnnnnnngattactacacctttttatcttaatcttaact |
228 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3854525 |
ttattggttttagcatgctcagagtttctgttgctgaatggttctagcatgctactagaaaaaaaa--gattactacacctttttatcttaatcttaact |
3854428 |
T |
 |
| Q |
229 |
atagttattttctttgcaaagagttgcatgttgcacattgctctttccatgttcccgatcacgcttttctaacttattcttttgcttaaataaaacaaaa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854427 |
atagttattttctttgcaaagagttgcatgttgcacattgctctttccatgttcgcgatcacgcttttctaacttattcttttgcttaaataaaacaaaa |
3854328 |
T |
 |
| Q |
329 |
ctctctctcaccatttatctgtagtattat |
358 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
3854327 |
ctctctctcaccatttatgtgtagtattat |
3854298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 84 - 147
Target Start/End: Complemental strand, 3854645 - 3854580
Alignment:
| Q |
84 |
gaaatccgaacaagagctatttgttgca--ccgagtttctgctgtttttattagttttagcatgct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3854645 |
gaaatccgaacaagagctatttgttgcagtcagagtttctgctgcttttattggttttagcatgct |
3854580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 198 - 239
Target Start/End: Complemental strand, 3854571 - 3854530
Alignment:
| Q |
198 |
attactacacctttttatcttaatcttaactatagttatttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854571 |
attactacacctttttatcttaatcttaactatagttatttt |
3854530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 3854687 - 3854654
Alignment:
| Q |
1 |
cagctccaaatgatcaaagaattacacctgtgtc |
34 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
3854687 |
cagctccaaatgatcaaagaattacacttgtgtc |
3854654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 46 - 234
Target Start/End: Original strand, 4142000 - 4142172
Alignment:
| Q |
46 |
tgttctaagccaacttcatttttaatgatctaacactagaaatccgaacaagagctatttgttgca--ccgagtttctgctgtttttattagttttagca |
143 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||| |||||||||||||| |||||| | |||||||||||| ||||||| |||||| |
|
|
| T |
4142000 |
tgttctaagccagcttcattttgaatgatctagcactagaaatctgaacaagagctattcgttgcactcggagtttctgctgcttttattgcttttag-- |
4142097 |
T |
 |
| Q |
144 |
tgctcagagtttctgttgctgaatgattctagcatgctactagnnnnnnnnnngattactacacctttttatcttaatcttaactatagtt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142098 |
------------ttgttgctgaatgattctagcatgctactcg----aaaaaagattactacacctttttatcttaatcttaactatagtt |
4142172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University