View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_42 (Length: 318)
Name: NF19445_low_42
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 4 - 279
Target Start/End: Original strand, 2467753 - 2468028
Alignment:
| Q |
4 |
atctttcaccacctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacattttt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467753 |
atctttcaccacctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacattttt |
2467852 |
T |
 |
| Q |
104 |
cgggctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgc |
203 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467853 |
cggtctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgc |
2467952 |
T |
 |
| Q |
204 |
ttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467953 |
ttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
2468028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University