View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_44 (Length: 310)
Name: NF19445_low_44
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 265
Target Start/End: Original strand, 41571793 - 41572057
Alignment:
| Q |
1 |
actttatttaaacatgtatttctttataactttctaagtgtttcaaaaataactcgtattgaatgttttgaacaacttaaaaagcaaaacacattttttg |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41571793 |
actttatttaaacaattatttctttataactttctaagagtttcaaaaataactcgtattgaatgttttgaacaacttaaaaagcaaaacacattttttg |
41571892 |
T |
|
| Q |
101 |
cggttgttgtatttgtcaacattgtgtggttgttaagaagttgtgaagtatatgttgcaataataacaaggagatactcacgttacatgatatttattgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41571893 |
cggttgttgtatttgtcaacattgtgtggttgttaagaagttgtgaagtatatgttgcaataataacaaggagatacccacgttacatgatatttattgt |
41571992 |
T |
|
| Q |
201 |
tggaatagtggaaaaatactttcaaaaggagatactaacctaatagatttattttcaccactcaa |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41571993 |
tggaatagtggaaaaatactttcaaaaggagatactaacctaatagatttattttcaccactcaa |
41572057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University