View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_45 (Length: 307)
Name: NF19445_low_45
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 36899842 - 36899976
Alignment:
| Q |
17 |
tccaaccaatgtggaccaaaaaagactatatataataaccattgtggcaaaccatagtgcatcacaaagtagagaaaggagagttgagaaattatcaatg |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
36899842 |
tccaacctatgtggaccaaaaaagactatatataataaccattgtggcaaaccatagtgcatcacaaagtagggaaaggagagttgagaaaatatcaatg |
36899941 |
T |
|
| Q |
117 |
gagaacatcaacttagacaccgaaaaaggaaccat |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
36899942 |
gagaacatcaacgtagacaccgaaaaaggaaccat |
36899976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 173 - 290
Target Start/End: Original strand, 36900001 - 36900118
Alignment:
| Q |
173 |
gtcaccaatcgaggaagtccggttaacggtgnnnnnnnccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctcatgc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36900001 |
gtcaccaatcgaggaagtccggttaacggtgaaaaaaaccgacgacccaacacttccagtatggaccttccgcatgtggtttctaggtcttctctcatgc |
36900100 |
T |
|
| Q |
273 |
gctctcctctcctttctc |
290 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
36900101 |
gctctcctctcctttctc |
36900118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University