View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_50 (Length: 285)
Name: NF19445_low_50
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 162 - 228
Target Start/End: Original strand, 23186406 - 23186472
Alignment:
| Q |
162 |
acacaccaccttcttcgtcccctaacttccaatgtactcaaatctttatcctcatcatcgattcatt |
228 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23186406 |
acacaccaccttcttcttcccctaacttccaatttactcaaatctttatcctcatcatcgattcatt |
23186472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 56 - 110
Target Start/End: Original strand, 23186354 - 23186408
Alignment:
| Q |
56 |
ttaactaacagaagcatttgaactacttccaactttatttcttgaattgccaaca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23186354 |
ttaactaacagaagcatttgaactacttccaactttatttcttgaattgccaaca |
23186408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 20 - 56
Target Start/End: Complemental strand, 23597044 - 23597008
Alignment:
| Q |
20 |
tgtatgagaataaaatatgtatatgtaacatttttct |
56 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
23597044 |
tgtatgagaataaaaaatgtctatgtaacatttttct |
23597008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 12 - 53
Target Start/End: Complemental strand, 20074913 - 20074872
Alignment:
| Q |
12 |
tcatcaggtgtatgagaataaaatatgtatatgtaacatttt |
53 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20074913 |
tcatgaggtgtatgagaataaaatgtgtctatgtaacatttt |
20074872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 41758734 - 41758771
Alignment:
| Q |
20 |
tgtatgagaataaaatatgtatatgtaacatttttctt |
57 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41758734 |
tgtatgagaataaaatgtgtctatgtaacatttttctt |
41758771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University