View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_51 (Length: 281)
Name: NF19445_low_51
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38720953 - 38721180
Alignment:
| Q |
1 |
gggaaatgagtttcaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgctgagcacaattgatta |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38720953 |
gggaaatgagttttaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgatgagcacaattgatta |
38721052 |
T |
 |
| Q |
101 |
tttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtcc------tgatcaatattcacaggtggtttaggcttgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
38721053 |
tttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtccatgttttcctcaatattcacaggtggtttaggcttgtt |
38721152 |
T |
 |
| Q |
195 |
cttagatcccgggggtctacccctaggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38721153 |
cttagatcccgggggtctacccctaggc |
38721180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University