View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_70 (Length: 227)
Name: NF19445_low_70
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_70 |
 |  |
|
| [»] chr7 (7 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 24012621 - 24012829
Alignment:
| Q |
18 |
tattagatctgcgaccccaaatccaagcacattgggtactatcgatgttacttggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24012621 |
tattagatctgcgaccccaaatccaagcacattgggtactatcgatgttacttggaagttatgtgggaaaagctagggagaaatgaagaggaaaagaatt |
24012720 |
T |
 |
| Q |
118 |
tgaaatcacaggaagccgataaacaaagcaggaaaatcatttggaagtttggttaggggttgatgggatgagacaatcagttaatttactttctgggagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24012721 |
tgaaatcacaggaagccgataaacaaagcaggaaaatcatttggaagtttggttaggggttgatgggatgagacaatcag-taatttactttctgggagt |
24012819 |
T |
 |
| Q |
218 |
taatttatat |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
24012820 |
taatttatat |
24012829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 23994428 - 23994557
Alignment:
| Q |
18 |
tattagatctgcgaccccaaatccaagcacattgggtactatcgatgttacttggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatt |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| | ||||||| |||||||||||||||| |||| |||| || |||||||| |||||||||||| ||| |
|
|
| T |
23994428 |
tattagatctgcgaccccaagtccaagcacattgaggactatcgttgttacttggaagtttggtggaaaaatcttgggagaaaggaagaggaaaagcatt |
23994527 |
T |
 |
| Q |
118 |
tgaaatcacaggaagccgataaacaaagca |
147 |
Q |
| |
|
||| | |||| || || ||||||| ||||| |
|
|
| T |
23994528 |
tgataacacaagatgcggataaactaagca |
23994557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 24036267 - 24036396
Alignment:
| Q |
18 |
tattagatctgcgaccccaaatccaagcacattgggtactatcgatgttacttggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatt |
117 |
Q |
| |
|
|||||||| || ||||||| ||||||||||||||| ||||| |||| ||| ||||||||| ||||||||| || || ||||| |||||||||||| ||| |
|
|
| T |
24036267 |
tattagatatgttaccccaactccaagcacattgggaactattgatgatacatggaagtttggtgggaaaatcttggaagaaaggaagaggaaaagcatt |
24036366 |
T |
 |
| Q |
118 |
tgaaatcacaggaagccgataaacaaagca |
147 |
Q |
| |
|
||| |||| | || || ||||||||||||| |
|
|
| T |
24036367 |
tgatatcataagacgcagataaacaaagca |
24036396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 55 - 147
Target Start/End: Original strand, 23997468 - 23997560
Alignment:
| Q |
55 |
actatcgatgttacttggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatttgaaatcacaggaagccgataaacaaagca |
147 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || |||||||||||||||||||| |||||| |||||| || || ||||||| ||||| |
|
|
| T |
23997468 |
actatggatgttacttggaagttttgtgggaaagtcttgggagaaatgaagaggaaaaacatttgatatcacaagacgcggataaactaagca |
23997560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 70 - 132
Target Start/End: Original strand, 24004298 - 24004360
Alignment:
| Q |
70 |
tggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatttgaaatcacaggaag |
132 |
Q |
| |
|
||||||||||||||||| || ||||||||||||| ||||||| |||||| ||||||||||| |
|
|
| T |
24004298 |
tggaagttttgtgggaaggtcttgggagaaatgaaggggaaaagcatttgatatcacaggaag |
24004360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 160 - 206
Target Start/End: Original strand, 24004356 - 24004401
Alignment:
| Q |
160 |
ggaagtttggttaggggttgatgggatgagacaatcagttaatttac |
206 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
24004356 |
ggaagtttggttagggcttgatgg-atgagacaatcagttaatttac |
24004401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 24032176 - 24032234
Alignment:
| Q |
18 |
tattagatctgcgaccccaaatccaagcacattgggtactatcgatgttacttggaagt |
76 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
24032176 |
tattagatctgtgagcccaagtccaagcacattggaaactattgatgttacatggaagt |
24032234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 126
Target Start/End: Original strand, 19742662 - 19742723
Alignment:
| Q |
65 |
ttacttggaagttttgtgggaaaagctagggagaaatgaagaggaaaagaatttgaaatcac |
126 |
Q |
| |
|
|||||||||||||| ||||||||| | | ||||||| ||| |||||||| |||||| ||||| |
|
|
| T |
19742662 |
ttacttggaagtttggtgggaaaatccatggagaaaggaataggaaaagcatttgatatcac |
19742723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University