View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19445_low_77 (Length: 201)
Name: NF19445_low_77
Description: NF19445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19445_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 17 - 173
Target Start/End: Original strand, 2468022 - 2468178
Alignment:
| Q |
17 |
tgatgatgcatccatgacagttttgaagtttatgctgttctctgcgttcttcgcacttcaagatgcttttccggcagttgctgcttctgattttgctact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2468022 |
tgatgatgcatccatgacagttttgaagtttatgctgttctccgcgttcttcgcacttcaagatgcttttccggcagttgctgcttctgattttgctact |
2468121 |
T |
|
| Q |
117 |
ggtttgaattcaattcctatatttggagatgtcggtgacttaagcacaggttctgct |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2468122 |
ggtttgaattcaattcctatatttggagatgtcggtgacttaagcacaggttttgct |
2468178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University