View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19446_high_10 (Length: 272)
Name: NF19446_high_10
Description: NF19446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19446_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 28144018 - 28144275
Alignment:
| Q |
1 |
tatatgatgtttttgttgcagatatgtttctattcggacgttggagagtgattgtcgttccagtaatcaacgttgtcttgttttttgggttctctttgct |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28144018 |
tatatgatgtttt-gttgcagatatgtttctattcggacgttggagagtgattgtcgttccagtaatcaacgttgtcttgttttttgggttctctttgct |
28144116 |
T |
|
| Q |
101 |
ttctctatgatcattgaacgtgaatttgcagtgttatttagttggtaatttcac----nnnnnnnnnnnnnnatatagtaagtctcattactttgctttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
28144117 |
ttctctatgatcattgaacgtgaatttgcagtgttatttagttggtaatttcacttttttattttattttttatatactaagtctcattactttgctttt |
28144216 |
T |
|
| Q |
197 |
attattttccgatcataagtagggcaaacaaccattttggtcggcgctgtcactatagt |
255 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28144217 |
attattttccgattataagtagggcaaacaaccattttggtcggcgctgtcactatagt |
28144275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University