View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19446_low_16 (Length: 218)

Name: NF19446_low_16
Description: NF19446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19446_low_16
NF19446_low_16
[»] chr6 (1 HSPs)
chr6 (16-197)||(23928469-23928650)


Alignment Details
Target: chr6 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 23928469 - 23928650
Alignment:
16 aatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttgaaaac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23928469 aatatgacggagcaaaaaagcacatgcaaatcactcaatggtgcgcgcacaacagcttcctgtacagaaacgttggagcaacaagcgacacgttgaaaac 23928568  T
116 caacaacgggacgactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg 197  Q
    || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23928569 cagcaacgggacaactcaaatgcaatatagacacgtccttcttcaccacttggaattgtgtggggttttcgatatgtattcg 23928650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University