View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19447_high_13 (Length: 209)
Name: NF19447_high_13
Description: NF19447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19447_high_13 |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 193
Target Start/End: Complemental strand, 25801524 - 25801365
Alignment:
| Q |
34 |
gtcaatgaaatgcacatgtttgattttaatcgattgttgagtaacttatccacaaatttttaacgacaacttaaaatttaccttgaaacaaactttgcat |
133 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25801524 |
gtcaatgaagtgcacatgtttgattttaatcgattgttgagtaacttatccacaaatttttaacgacaacttaaaatttaccttgaaacaaactttgcat |
25801425 |
T |
 |
| Q |
134 |
tatagaattctaattcattgcataatggcttatggttgaagagattggaaaggaattatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25801424 |
tatagaattctaattcattgcataatggcttatggttgaagagattggaaaggaattatg |
25801365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 42 - 193
Target Start/End: Original strand, 113002 - 113153
Alignment:
| Q |
42 |
aatgcacatgtttgattttaatcgattgttgagtaacttatccacaaatttttaacgacaacttaaaatttaccttgaaacaaactttgcattatagaat |
141 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| | ||||| | | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113002 |
aatgcacatgtttaattttaatcgattgttgagtaacctatccaaattttttttaaggcaacttaaaatttaccttgaaacaaactttgcattatagaat |
113101 |
T |
 |
| Q |
142 |
tctaattcattgcataatggcttatggttgaagagattggaaaggaattatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
113102 |
tctaattcattgcataatggcttatggttgaagagattggaaaggaattatg |
113153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University