View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19448_high_10 (Length: 381)
Name: NF19448_high_10
Description: NF19448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19448_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 17 - 364
Target Start/End: Original strand, 42021143 - 42021490
Alignment:
| Q |
17 |
acaaaggtactgatacgtttcaatatcaaaattttgaagtcaaagttttatgggatctttctgatgctaagtatgatgaaggacctgaaccggttaatgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021143 |
acaaaggtactgatacgtttcaatatcaaaattttgaagtcaaagttttatgggatctttctgatgctaagtatgatgaaggacctgaaccggttaatgg |
42021242 |
T |
 |
| Q |
117 |
attttacgtcatggttttggtgaactctgaattgggtttattcctcggagacaaagaagaagattcgttgaagaacttggaagataagaaaaaccatgat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42021243 |
attttacgtcatggttttggtgaactctgaattgggtttattcctcggagacaaagaagaagattcgttggagaacttggaagataagaaaaaccatgat |
42021342 |
T |
 |
| Q |
217 |
gcaaaattctcaatggtttcaagaagtgaaagattttatggtacaagtgtttatgcaacaaaggcaaagttttctgaaacaggaatttcacacgatatat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021343 |
gcaaaattctcaatggtttcaagaagtgaaagattttatggtacaagtgtttatgcaacaaaggcaaagttttctgaaacaggaatttcacacgatatat |
42021442 |
T |
 |
| Q |
317 |
tgataaagtgtggagtagaagaagaaggatcaacatcaaagagtcaca |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021443 |
tgataaagtgtggagtagaagaagaaggatcaacatcaaagagtcaca |
42021490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University