View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19448_high_19 (Length: 299)
Name: NF19448_high_19
Description: NF19448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19448_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 12514080 - 12513813
Alignment:
| Q |
19 |
acaggggatgctgtgaaactttttgctggtgagagttactcgtctgtatgtgctttcgtgaactaccgagtgaagaaacttgcatataattgtattcgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12514080 |
acaggggatgctgtgaaactttttgctggtgagagttactcgtctgtatgtgctttcgtgaactaccgagtgaagaaacttgcatataattgtattcgtg |
12513981 |
T |
 |
| Q |
119 |
tagtacatcataataggtttgctttatttatttactttaatttcgctaattctgggcctttggcttttcttatttacttgccatcacttttctcattcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12513980 |
tagtacatcataataggtttgctttatttatttactttaatttcgctaattctgggcctttggcttttcttattctcttgccatcacttttctcattcat |
12513881 |
T |
 |
| Q |
219 |
ttattattacttgtagaacatcacattttgattatattatcacttgaatgatttcgaatgttaaacct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| ||||||| |
|
|
| T |
12513880 |
ttattattacttgtagaacatcacattttgattatattatcacttgattgatttagaatggtaaacct |
12513813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 12485388 - 12485182
Alignment:
| Q |
19 |
acaggggatgctgtgaaactttttgctggtgagagttactcgtctgtatgtgctttcgtgaactaccgagtgaagaaacttgcatataattgtattcgtg |
118 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| | |||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12485388 |
acagggaatgctgtgagactttttgctggtgaaaattactcatctgtatgtgctctcgtgaactaccgggtgaagaaacttgcatataattgtattcgtg |
12485289 |
T |
 |
| Q |
119 |
tagtacatcataataggtttgctttatttatttactttaatttcgctaattctgggcctttggcttttcttatttacttgccatcacttttctcattcat |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| ||| |||||| ||||| |||||||||||||||| |||||| | ||||| ||| ||||| |
|
|
| T |
12485288 |
cagtacatcataataggtttgctttacttatttattttaa-ttcactaattttgggcttttggcttttcttattctcttgccgttactttcctc-ttcat |
12485191 |
T |
 |
| Q |
219 |
ttattatta |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
12485190 |
ttattatta |
12485182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University