View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19448_high_3 (Length: 442)

Name: NF19448_high_3
Description: NF19448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19448_high_3
NF19448_high_3
[»] chr5 (1 HSPs)
chr5 (345-432)||(18027025-18027113)


Alignment Details
Target: chr5 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 345 - 432
Target Start/End: Complemental strand, 18027113 - 18027025
Alignment:
345 agttaaatcatgttttaaggtcaactttgtaactcacctaattaacgtacgaa-taatcgcatattcgtaatgtgatactcatattctt 432  Q
    |||||||| || ||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||||    
18027113 agttaaataatttttcaaggtcaactttgtaactcacctaattaacgtaccaattaatcgcatattcgtaatgtgatacccatattctt 18027025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University