View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19448_low_27 (Length: 243)

Name: NF19448_low_27
Description: NF19448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19448_low_27
NF19448_low_27
[»] chr1 (1 HSPs)
chr1 (14-225)||(30083235-30083446)


Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 30083235 - 30083446
Alignment:
14 cacagaacaaagaaagtaatgtttgtacctgagtatgagcgtggcttctgaattgagttgtagagtggagaagagaatgcaagagagtgcatagttgcca 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30083235 cacaaaacaaagaaagtaatgtttgtacctgagtatgagcgtggcttctgaattgagttgtagagtggagaagagaatgcaagagagtgcatagttgcca 30083334  T
114 ttgccaagaaaagagagaagcagttcttctcaacaccttgcttctctagttgtcataaaatcaaaagatagaagtaaaattgtggtccacaaaatgtcta 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
30083335 ttgccaagaaaagagagaagcagttcttctcaacaccttgcttctctagttgtcataaaatcaaaagatagaagtaaaattgtggtccacaaagtgtcta 30083434  T
214 ttgtgtcacaaa 225  Q
    ||||||||||||    
30083435 ttgtgtcacaaa 30083446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University