View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19448_low_27 (Length: 243)
Name: NF19448_low_27
Description: NF19448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19448_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 30083235 - 30083446
Alignment:
| Q |
14 |
cacagaacaaagaaagtaatgtttgtacctgagtatgagcgtggcttctgaattgagttgtagagtggagaagagaatgcaagagagtgcatagttgcca |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30083235 |
cacaaaacaaagaaagtaatgtttgtacctgagtatgagcgtggcttctgaattgagttgtagagtggagaagagaatgcaagagagtgcatagttgcca |
30083334 |
T |
 |
| Q |
114 |
ttgccaagaaaagagagaagcagttcttctcaacaccttgcttctctagttgtcataaaatcaaaagatagaagtaaaattgtggtccacaaaatgtcta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30083335 |
ttgccaagaaaagagagaagcagttcttctcaacaccttgcttctctagttgtcataaaatcaaaagatagaagtaaaattgtggtccacaaagtgtcta |
30083434 |
T |
 |
| Q |
214 |
ttgtgtcacaaa |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30083435 |
ttgtgtcacaaa |
30083446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University