View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19449_high_17 (Length: 322)
Name: NF19449_high_17
Description: NF19449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19449_high_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 11 - 322
Target Start/End: Complemental strand, 33081943 - 33081632
Alignment:
| Q |
11 |
cacagacagtgtaatggaaaacgccgacgcttcctctggtttacacgacttcctcgagcgcatgcgccaacccgccgccgccgatttcgtcaaagctatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081943 |
cacagacagtgtaatggaaaacgccgacgcttcctctggtttacacgacttcctcgagcgcatgcgccaacccgccgccgccgatttcgtcaaagctatc |
33081844 |
T |
|
| Q |
111 |
aaaaggttccttccttcttcttttcaccatcttaatttcaatccgaaccctaatcaattcactgatgcattgcaataattatagttttacagtttcatag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
33081843 |
aaaaggttccttccttcttcttttcaccatcttaatttcaatccgaaccctaatcaattcactgatgcatagcaataattatgattttacagtttcatag |
33081744 |
T |
|
| Q |
211 |
tttcattttcaaatcatggacccgatcctgagagagacagtgatgccgtacaagactttcttgctaatatggaagctgctttcaaagctcatcccctttg |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081743 |
tttcgttttcaaatcatggacccgatcctgagagagacagtgatgccgtacaagactttcttgctaatatggaagctgctttcaaagctcatcccctttg |
33081644 |
T |
|
| Q |
311 |
ggccggttgctc |
322 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33081643 |
ggccggttgctc |
33081632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University