View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_24 (Length: 333)
Name: NF1944_high_24
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 21172249 - 21172034
Alignment:
| Q |
1 |
tatgaattgatgggtacagctaccagaattgtgacactttccaaacactacgaccaaaatgacgattggcctagtattcttccctttactttattattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21172249 |
tatgaattgatgggtacagctaccagaattgtgacactttccaaacactacgaccaaaatgacgat-ggcctagtattcttccctttactttattattat |
21172151 |
T |
 |
| Q |
101 |
actatagttatcaaataaccggtgggctaagtggaaaatctcaattttgaatgtattctttagttataaaatgatgtagcaatgttgttataacttataa |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21172150 |
actatagttatcaaataaccggtgg-ctaagtggaaaatctcaattttgaatgtattctttagttataaaatgatatagcaatgttgttataacttataa |
21172052 |
T |
 |
| Q |
201 |
gtatcatttgagtttcct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
21172051 |
gtatcatttgagtttcct |
21172034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 316
Target Start/End: Complemental strand, 21171576 - 21171543
Alignment:
| Q |
283 |
tttcttgaattgtggtgaagtttctagacagttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21171576 |
tttcttgaattgtggtgaagtttctagacagttg |
21171543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University