View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_29 (Length: 276)
Name: NF1944_high_29
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 42269693 - 42269932
Alignment:
| Q |
19 |
cctcaaagacacataagatccatatgtgtcaaacaacactgaaccctaaaggtgtcaac----aaagaattggttttgtctcccactcataaggggagct |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
42269693 |
cctcaaagacatataagatccatatgtgtcaaacaacattgaaccctaaaggtgtcaacgtacaaagaattggtt--gtctcccactcgtaaggggagcc |
42269790 |
T |
 |
| Q |
115 |
gcg--acgcctagggaatttactaaagaaccactcccaagaatgaaaaataatcccatcaacatgttgctgctcagtctcgaagttacttcttgagaaag |
212 |
Q |
| |
|
||| | |||||| |||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42269791 |
gcgcgatgcctagagaatttaccaaagaatcactcccaagaatgaaaaataatccaatcaacatgttgctgctcagtctcgaagttacttcttgagaaag |
42269890 |
T |
 |
| Q |
213 |
gtcattacggacttttcaaatataccacacagtcgcatgccc |
254 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
42269891 |
gtcattacgaacttttcaaatataccacacattcgcatgccc |
42269932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 93 - 146
Target Start/End: Original strand, 31222444 - 31222497
Alignment:
| Q |
93 |
tctcccactcataaggggagctgcgacgcctagggaatttactaaagaaccact |
146 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
31222444 |
tctcccactcataaagggagcaacgatgcctagggaatttattaaagaaccact |
31222497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University