View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_31 (Length: 265)
Name: NF1944_high_31
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 44879174 - 44878928
Alignment:
| Q |
1 |
cacagaggtgtactatatttacaattttatcattctttacccgatcaagcgaatattgtttgaattggatttaactcattcataagacttaaaatctcaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44879174 |
cacacaggtgtactatatttacaattttatcattctttacccgatccagcgaatattgttttaattggatttaagtcattcataagacttaaaatctcaa |
44879075 |
T |
|
| Q |
101 |
tggtttaattggcttgagtaatatttgtttggcaggcttctagtgtacgagttcatgaagaatggttcattggataaatggatcttcccttcatatcgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44879074 |
tggtttaattggcttgagtaatatttgtttggcaggcttctagtgtacgagttcatgaagaatggttcattggataaatggatcttcccttcatatcgag |
44878975 |
T |
|
| Q |
201 |
ggcgagatagattgctagattggcaaactcgtttcgatatagccata |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44878974 |
ggcgagatagattgctagattggcaaactcgtttcgatatagccata |
44878928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University