View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_47 (Length: 242)
Name: NF1944_high_47
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 5703496 - 5703717
Alignment:
| Q |
18 |
attaggaagtttcaatcatttgagatgttgccatacaggatgagtttgttagacaattagtggttacacccgtcttcttgtatataaactgattccattg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5703496 |
attaggaagtttcaatcatttgagatgttgccatataggatgagtttgttagacaattagt---tacactcgtcttcttgtatataaactgattccattg |
5703592 |
T |
 |
| Q |
118 |
agaaataaatcagaatgtgcatttttgactattattatacgaccttgatgactctttgggagaaacttgaacattaccatccaattccccaatgctggag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5703593 |
agaaataaatcagaatgtgcatttttgactattattatacgacattgatgactctttgggagaaacttgaacattaccatccaattccccaatgctggag |
5703692 |
T |
 |
| Q |
218 |
aatttaggttagaagactgtgttgt |
242 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
5703693 |
aatttaggttagaagactatgttgt |
5703717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University