View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_51 (Length: 236)
Name: NF1944_high_51
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 47368607 - 47368808
Alignment:
| Q |
17 |
cagagaataatgtagttgtgagtgtgtctataaaataataaaagtagtattgcatcaatatacatcatttttcggtgtttacagtatcaagaaatggtat |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47368607 |
cagagaatagtgtagttgtgagtgtgtctataaaataataaaagtagtattgcatcaatatacatcatttttcggtgtttacagtatcaagaaatggtat |
47368706 |
T |
 |
| Q |
117 |
tatggaacctcatttacagagnnnnnnngtgttaatttcttaacttttttggtttatactttacaggcattccttttctgcttataaattttcctccatg |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47368707 |
tatggaacctcatttacagagaaaaaaagtgttaatttcttaacttttttggtttatactttacaggcattccttttctgcttataaattttcctccatg |
47368806 |
T |
 |
| Q |
217 |
tt |
218 |
Q |
| |
|
|| |
|
|
| T |
47368807 |
tt |
47368808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University