View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_high_59 (Length: 208)
Name: NF1944_high_59
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 42224690 - 42224514
Alignment:
| Q |
16 |
attattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcgctaaatattttatcatatttaagannnnnnnnattgatttgtgcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42224690 |
attattcttatacgaggacaataaatgttgaagttatgaaaaaattaaggaagcactaaatattttatcatatttaagattttttttattgatttgtgcc |
42224591 |
T |
 |
| Q |
116 |
tgtaatgccatgttggggcaagaattttctctcnnnnnnnnctaggttaaagaagaatatggctcttgtatgctttg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224590 |
tgtaatgccatgttggggcaagaattttctctcttttttttctaggttaaagaagaatatggctcttgtatgctttg |
42224514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University