View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_low_32 (Length: 301)
Name: NF1944_low_32
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 180 - 292
Target Start/End: Complemental strand, 31504838 - 31504726
Alignment:
| Q |
180 |
gataagaaataaacacaaagacgtaggcatgtgaatgtttggagactgctcactttttgggatataaaatatttgacccttgtttttgattaggtcgtgc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31504838 |
gataagaaataaacacaaagacgtaggcatgtgaatgtttggagactgctcactttttgggatataaaatatttgacccttgttttagattaggtcgtgc |
31504739 |
T |
|
| Q |
280 |
ttatatacctatg |
292 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31504738 |
ttatatacctatg |
31504726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 6 - 108
Target Start/End: Complemental strand, 31505012 - 31504910
Alignment:
| Q |
6 |
aattgatacgatcatatatactgtcatggaatagagattaaattagagaacagaatccagcagaagaacacactaattgttcccccacatatcatgtgca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31505012 |
aattgatacgatcatatatactgtcatggaatagagattaaattagagaacagaatccagcagaagaacacactaattgttcccccacatatcatgtgca |
31504913 |
T |
|
| Q |
106 |
tag |
108 |
Q |
| |
|
||| |
|
|
| T |
31504912 |
tag |
31504910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University