View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1944_low_37 (Length: 265)

Name: NF1944_low_37
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1944_low_37
NF1944_low_37
[»] chr1 (1 HSPs)
chr1 (1-247)||(44878928-44879174)


Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 44879174 - 44878928
Alignment:
1 cacagaggtgtactatatttacaattttatcattctttacccgatcaagcgaatattgtttgaattggatttaactcattcataagacttaaaatctcaa 100  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||    
44879174 cacacaggtgtactatatttacaattttatcattctttacccgatccagcgaatattgttttaattggatttaagtcattcataagacttaaaatctcaa 44879075  T
101 tggtttaattggcttgagtaatatttgtttggcaggcttctagtgtacgagttcatgaagaatggttcattggataaatggatcttcccttcatatcgag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44879074 tggtttaattggcttgagtaatatttgtttggcaggcttctagtgtacgagttcatgaagaatggttcattggataaatggatcttcccttcatatcgag 44878975  T
201 ggcgagatagattgctagattggcaaactcgtttcgatatagccata 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
44878974 ggcgagatagattgctagattggcaaactcgtttcgatatagccata 44878928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University