View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_low_42 (Length: 255)
Name: NF1944_low_42
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34295029 - 34295273
Alignment:
| Q |
1 |
acgcattattttttcttatttagtgaaccttattggtactatttgataccatattaatgcattacagacagaaagcaatagtttcagaggccgggttcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34295029 |
acgcattattttttcttatttagtgaaccttattggtactagttgataccatattaatgcattacagacagaaagcaatagtttcagaggccgggttcta |
34295128 |
T |
 |
| Q |
101 |
gatggaaatgccaaatcgattggtccatgagagtgataaagaattatggctgctttggttaaattccgcaaaatttgattaatcaatg--tttttcttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34295129 |
gatggaaatgccaaatcgattggtccatgagagtgataaagaattatggctgctttggttaaattccgcaaaatttgattaatcaatgtttttttcttct |
34295228 |
T |
 |
| Q |
199 |
tctttcaattatgtgtatggaccaccttttttatgagaataatct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34295229 |
tctttcaattatgtgtatggaccaccttttttatgagaattatct |
34295273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University