View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_low_50 (Length: 244)
Name: NF1944_low_50
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_low_50 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 13264703 - 13264935
Alignment:
| Q |
12 |
actagtatcatgttctctttgtattattctcttcattatattgatgtttacaaaacacagatagtacaacacaattgaggaattagtatgcattattcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13264703 |
actagtatcatgttctctttgtattattctcttcattatattgatgtttacaaaacacagatagtacaacacaattgaggaattagtatgcattattcat |
13264802 |
T |
|
| Q |
112 |
caacataatagattaacaactgtattaaaaaagacacgatgtcattggcataaatgtatacctgatggaaactttcatttttcttatttgttgtacttca |
211 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13264803 |
caacataatagattaacaacggtgttaaaaaagacaagatgtcattggcataaatgtatacctgatggaaactttcatttttcttatttgttgtacttca |
13264902 |
T |
|
| Q |
212 |
tgcttgatttttcaaaaccaatggttggaaatt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13264903 |
tgcttgatttttcaaaaccaatggttggaaatt |
13264935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University