View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_low_61 (Length: 231)
Name: NF1944_low_61
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_low_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 106 - 213
Target Start/End: Complemental strand, 4265139 - 4265032
Alignment:
| Q |
106 |
actagttcaaatattatataatgaccctggcccttgtggtccaatcatagggactagatgtacacatcattattccaatcttcatctaatttcatagttc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4265139 |
actagttcaaatattatataatgaccctggcccttgtggtccaatcatagggactagatgtacacatcattattccaatcttcatctaatttcatagttc |
4265040 |
T |
 |
| Q |
206 |
caagtgga |
213 |
Q |
| |
|
|||||||| |
|
|
| T |
4265039 |
caagtgga |
4265032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 4265242 - 4265172
Alignment:
| Q |
14 |
aagaatattgtttcaatgtaaaacaaaattaggcatttcccactgcaataataaactggttatgtgcaccc |
84 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4265242 |
aagaaaattgtttcaatgtaaaacaaaattaggcatttcccactgcaataataaactggttatgtacaccc |
4265172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University