View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1944_low_67 (Length: 212)
Name: NF1944_low_67
Description: NF1944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1944_low_67 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 212
Target Start/End: Original strand, 40325385 - 40325584
Alignment:
| Q |
13 |
agatgaaggtgatttcaaaccgagatcatgttaagnnnnnnnttgaagcaactgatcgtttaaccgaaagggtgaatgatgatgtgtttgagtggctaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40325385 |
agatgaaggtgatttcaaaccgagatcatgttaagaaaaaaattgaagcaactgatcgtttaaccgaaagggtgaatgatgatgtgtttgagtggctaag |
40325484 |
T |
|
| Q |
113 |
agaaatagaaatagttttacaagaagtggagaatatgacagtagtggatgaacttggtcaattgtcaagacaagaaaaacataggcaattgacgaatgat |
212 |
Q |
| |
|
||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40325485 |
agaaacagaaatagttttacaagaggtggggaatatgacagtagtggatgaacttgggcaattgtcaagacaagaaaaacataggcaattgacgaatgat |
40325584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University