View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19450_high_13 (Length: 236)
Name: NF19450_high_13
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19450_high_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 19770266 - 19770486
Alignment:
| Q |
16 |
ctttttgcccaatgtagaacatcacacttttatatgcacttttcattactaaattttcttaaggtaaaacaattggtcaaatgtaaacttaagttcttta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19770266 |
ctttttgcccaatgtagaacatcacacttttatatgcacttttcattactaaattttcttaaggtaaaacaattggtcaaatgtaaacttaagttcttta |
19770365 |
T |
 |
| Q |
116 |
atttcagaatatccccttcattaacgttagtcaacccctgagatactacagaatgctataacatgcaaaattaatttcaaattttctatgccgtgccttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19770366 |
atttcagaatatccccttcattaacgttagtcaacccctgagatactacagaatgctataacatgcaaaattaatttcaaattttctatgccgtgccttc |
19770465 |
T |
 |
| Q |
216 |
taaacaatgagcataaaggat |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19770466 |
taaacaatgagcataaaggat |
19770486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University