View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19450_high_15 (Length: 224)
Name: NF19450_high_15
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19450_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 108 - 218
Target Start/End: Complemental strand, 15323011 - 15322901
Alignment:
| Q |
108 |
tatgctgcatcaaattccatgaactttagatgaaggcatgcagcttgattgctattattcttttaatgttaaataggatgcaactgttcctttgataatt |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15323011 |
tatgcttcatcaaattccatgaactttagatcaaggcatgcagcttgattgctattatgcttttaatgttaaataggatgcaactgttcctttgataatt |
15322912 |
T |
 |
| Q |
208 |
ttttcttgttc |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
15322911 |
ttttcttgttc |
15322901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 15323152 - 15323047
Alignment:
| Q |
1 |
tgtccgtgtcgtgtccgatatccgggtccatgcttcatagaattctactaataataagagcgaaagaagacatggcaacatgggtaactgtgaccaatga |
100 |
Q |
| |
|
||||| ||||||||||| | |||| |||||||||| ||||||| | | |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15323152 |
tgtccatgtcgtgtccggtgtccgtgtccatgctttatagaataccagtaataataagagcgaaagaagacatggcaagatgggtaactgtgaccaatga |
15323053 |
T |
 |
| Q |
101 |
aagctt |
106 |
Q |
| |
|
|||||| |
|
|
| T |
15323052 |
aagctt |
15323047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 15313005 - 15312946
Alignment:
| Q |
160 |
tattattcttttaa-tgttaaataggatgcaactgttcctttgataattttttcttgttc |
218 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||| |
|
|
| T |
15313005 |
tattattcttttaaatgttaaataggatgcaactgtttctttaatacttttttcttgttc |
15312946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University