View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19450_high_4 (Length: 449)

Name: NF19450_high_4
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19450_high_4
NF19450_high_4
[»] chr5 (2 HSPs)
chr5 (81-285)||(8518350-8518553)
chr5 (328-449)||(8518598-8518719)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 81 - 285
Target Start/End: Original strand, 8518350 - 8518553
Alignment:
81 tcgtttataaaaaggatcaatggaaaaggcattgcctttcaaatattgcttaaaccagtttaaaccaaacagaacaacatacgataacatagtannnnnn 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||           
8518350 tcgtttataaaaaggatcaatggaaaaggcattgcctttcaaatattgctaaaaccagtttaaaccaaacagaacaacatacgataacatagt-tttttt 8518448  T
181 nnngttaannnnnnntccggttctcggttgaagaggtcattggcaatgatagtatggaatttgtttgagagttaagtaaagtcttgctaaaaattgtttc 280  Q
       |||||       ||||||||| ||| |||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||| |||||||||||||    
8518449 tttgttaaccccccctccggttcttggtagaagaggtcattggcattgacagtatggaatttgtttgagagttaagtaaaatcttgttaaaaattgtttc 8518548  T
281 acttg 285  Q
    |||||    
8518549 acttg 8518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 328 - 449
Target Start/End: Original strand, 8518598 - 8518719
Alignment:
328 ccttagataaaattacttggttagagaacttcttaattatgacatatgggttatgccccattttcataatctatggttttataaggaattggaatatgaa 427  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
8518598 ccttagataaaattactttgttagagaacttcttaattatgacatatgggttatgccccattttcagaatctatggttttataaggaattggaatatgaa 8518697  T
428 ttatgaaacagaagctggctga 449  Q
    ||||||||||||||||||||||    
8518698 ttatgaaacagaagctggctga 8518719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University