View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19450_high_4 (Length: 449)
Name: NF19450_high_4
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19450_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 81 - 285
Target Start/End: Original strand, 8518350 - 8518553
Alignment:
| Q |
81 |
tcgtttataaaaaggatcaatggaaaaggcattgcctttcaaatattgcttaaaccagtttaaaccaaacagaacaacatacgataacatagtannnnnn |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518350 |
tcgtttataaaaaggatcaatggaaaaggcattgcctttcaaatattgctaaaaccagtttaaaccaaacagaacaacatacgataacatagt-tttttt |
8518448 |
T |
 |
| Q |
181 |
nnngttaannnnnnntccggttctcggttgaagaggtcattggcaatgatagtatggaatttgtttgagagttaagtaaagtcttgctaaaaattgtttc |
280 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||||| ||| |||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
8518449 |
tttgttaaccccccctccggttcttggtagaagaggtcattggcattgacagtatggaatttgtttgagagttaagtaaaatcttgttaaaaattgtttc |
8518548 |
T |
 |
| Q |
281 |
acttg |
285 |
Q |
| |
|
||||| |
|
|
| T |
8518549 |
acttg |
8518553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 328 - 449
Target Start/End: Original strand, 8518598 - 8518719
Alignment:
| Q |
328 |
ccttagataaaattacttggttagagaacttcttaattatgacatatgggttatgccccattttcataatctatggttttataaggaattggaatatgaa |
427 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8518598 |
ccttagataaaattactttgttagagaacttcttaattatgacatatgggttatgccccattttcagaatctatggttttataaggaattggaatatgaa |
8518697 |
T |
 |
| Q |
428 |
ttatgaaacagaagctggctga |
449 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8518698 |
ttatgaaacagaagctggctga |
8518719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University