View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19450_high_8 (Length: 370)
Name: NF19450_high_8
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19450_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 16 - 343
Target Start/End: Complemental strand, 36990732 - 36990405
Alignment:
| Q |
16 |
aatatgttgttattgaagggttttggtggcacagac---gacatgagttcatgaggggatgataatgggagcttgtgatctgaatggttgttgaattctg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990732 |
aatatgttgttattgaagggttttggtggcacagacatggacatgagttcatgaggggatgataatgggagcttgtgatctgaatggttgttgaattctg |
36990633 |
T |
 |
| Q |
113 |
atacagttccaccaatttgagggttattaatggggtttaaaggtaatgaagaaacgagatttgagattggttggtgttgcaagtttgatagtactccttc |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990632 |
atacagttccacaaatttgagggttattaatggggtttaaaggtaatgaagaaacgagatttgagattggttggtgttgcaagtttgatagtactccttc |
36990533 |
T |
 |
| Q |
213 |
gttggctttgttgttctcttcagctaatgcgtcacagaatgctctgtgggtaatgaagctgtctcttctgcatatagtaaataaatcaattaataagaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990532 |
gttggctttgttgttctcttcagccaatgcgtcacagaatgctctgtgggtaatgaagctgtctcttctgcatatagtaaataaatcaattaataagaaa |
36990433 |
T |
 |
| Q |
313 |
ctctcttagccaggtgaatatgtaagttaaa |
343 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |
|
|
| T |
36990432 |
ctctc-tagccaggtga--atgtaagttaaa |
36990405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 283
Target Start/End: Original strand, 44150142 - 44150204
Alignment:
| Q |
221 |
tgttgttctcttcagctaatgcgtcacagaatgctctgtgggtaatgaagctgtctcttctgc |
283 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||||||||||| || || |||||||| |||| |
|
|
| T |
44150142 |
tgttgttttcttcagttaatgcatcacagaatgctctgtgggttataaaactgtctctcctgc |
44150204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University