View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19450_low_15 (Length: 281)
Name: NF19450_low_15
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19450_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 8270192 - 8270437
Alignment:
| Q |
18 |
atgaaggtagttaaaacgggtaggtagacactagacaagcttaaatcagggacataaaattggaagttcaaagtattggtgagggtgaggacgtgtatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8270192 |
atgaaggtagttaaaacgggtaggtagacactagacaagcttaaatcagggacataaaattggaagttcaaagtattggtgagggtgaggacgtgtatgt |
8270291 |
T |
 |
| Q |
118 |
gttgtgtgataagaggaattgtgtgactatgatatgagatgtcatcactcatcaatgtgaggagtaaattgtttatggaccaatgaacttcttgtcctat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8270292 |
gttgtgtgataagaggaattgtgtgactatgatatgagatgtcatcactcatcaatgtgaggagtaaattgtttatggaccaatgaacttcttgtcctat |
8270391 |
T |
 |
| Q |
218 |
tactagtacgaagcaacttacaatatggccctccaagtgggttaac |
263 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8270392 |
tactagtacgaaacaacttacaatatggccctccaagtgggttaac |
8270437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University