View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19450_low_18 (Length: 224)

Name: NF19450_low_18
Description: NF19450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19450_low_18
NF19450_low_18
[»] chr1 (3 HSPs)
chr1 (108-218)||(15322901-15323011)
chr1 (1-106)||(15323047-15323152)
chr1 (160-218)||(15312946-15313005)


Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 108 - 218
Target Start/End: Complemental strand, 15323011 - 15322901
Alignment:
108 tatgctgcatcaaattccatgaactttagatgaaggcatgcagcttgattgctattattcttttaatgttaaataggatgcaactgttcctttgataatt 207  Q
    |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
15323011 tatgcttcatcaaattccatgaactttagatcaaggcatgcagcttgattgctattatgcttttaatgttaaataggatgcaactgttcctttgataatt 15322912  T
208 ttttcttgttc 218  Q
    |||||||||||    
15322911 ttttcttgttc 15322901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 15323152 - 15323047
Alignment:
1 tgtccgtgtcgtgtccgatatccgggtccatgcttcatagaattctactaataataagagcgaaagaagacatggcaacatgggtaactgtgaccaatga 100  Q
    ||||| ||||||||||| | |||| |||||||||| ||||||| | | |||||||||||||||||||||||||||||| |||||||||||||||||||||    
15323152 tgtccatgtcgtgtccggtgtccgtgtccatgctttatagaataccagtaataataagagcgaaagaagacatggcaagatgggtaactgtgaccaatga 15323053  T
101 aagctt 106  Q
    ||||||    
15323052 aagctt 15323047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 15313005 - 15312946
Alignment:
160 tattattcttttaa-tgttaaataggatgcaactgttcctttgataattttttcttgttc 218  Q
    |||||||||||||| |||||||||||||||||||||| |||| ||| |||||||||||||    
15313005 tattattcttttaaatgttaaataggatgcaactgtttctttaatacttttttcttgttc 15312946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University