View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19451_high_4 (Length: 277)
Name: NF19451_high_4
Description: NF19451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19451_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 34 - 277
Target Start/End: Original strand, 5829580 - 5829827
Alignment:
| Q |
34 |
aatttcagatttgtttaagttcttggtaactcatttgatatctatcgtaaattttgtatcaataaattaggtacttgcttaaaacaatgatgtatcataa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5829580 |
aatttcagatttgtttaagttcttggtaactcatttgatatctatcgtaaattttgtatcaataaattatgtacttgcttaaaacaatgatgtatcataa |
5829679 |
T |
|
| Q |
134 |
at---gatcatatttgattcccctttgtcttaatgctgaaggaaccgttaatagacttgtcggtggtactttctggttctggagcaggattgtgctcaat |
230 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5829680 |
attaagatcatatttgattcccctttgtcttaatgctgaaggaaccgttaatagacttctcggtggtactttctggttctggagcatgattgtgctcaat |
5829779 |
T |
|
| Q |
231 |
cctctaatcacctgaattgtga-ttagaagaatgagttgtttcctcct |
277 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
5829780 |
cctctaatcacctgaattgtgatttagaagaatgagttgtttcatcct |
5829827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University