View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_high_32 (Length: 250)
Name: NF19453_high_32
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 34138025 - 34137786
Alignment:
| Q |
9 |
ggtctatattatcaactataaacatcatttattcaatgaaatcatatagtaatgttagtgacatcacatgtaactaatgctaactaactacgttatatga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34138025 |
ggtctatattatcaactataaacatcatttattcaatgaaatgatatagtaatgttagtgacatcacatgtaactaatgctaactaactacgttatatga |
34137926 |
T |
 |
| Q |
109 |
gatatgattgcattaagtgagattact-------accgttactaatattattaa-ttgttaatatttgattaatttggtcaatgctcagttaatattc-t |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34137925 |
gatatgattgcattaagtgagattactaccgactaccgttactaatattattaatttgttaatatttgattaatttggtcaatgctcagttaatattctt |
34137826 |
T |
 |
| Q |
200 |
ttttaggaagtaagtaataaaattagtttttgttcatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34137825 |
ttttaggaagtaagtaataaaattagtttttgttcatatt |
34137786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University