View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19453_high_37 (Length: 239)

Name: NF19453_high_37
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19453_high_37
NF19453_high_37
[»] chr4 (3 HSPs)
chr4 (121-225)||(34139108-34139211)
chr4 (4-99)||(34138102-34138195)
chr4 (161-219)||(34136197-34136255)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 121 - 225
Target Start/End: Original strand, 34139108 - 34139211
Alignment:
121 atgagataaattgcatacatactgcacccagtaattctaatagcaagtttgactgtagccagttgctcatttcagaaacaccgatcaatctttggttgtt 220  Q
    ||||||||||||||||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||    
34139108 atgagataaattgcatacataatgcacccagtaattctaata-caaatttgattgtagccagttgctcattttagaaacaccgatcaatctttggttgtt 34139206  T
221 tacat 225  Q
    |||||    
34139207 tacat 34139211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 99
Target Start/End: Original strand, 34138102 - 34138195
Alignment:
4 agactttgaatacaaaatattgataacttgtcttctttatatttgacctatattaaaaatgagatacataaattattcaataaatatgtaaaataa 99  Q
    |||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||| ||||||||||||||||||||||||| |||||||    
34138102 agactttgaatacaaaatattgataacttgtcttctctat--ttgacctatattaaaaatgaaatacataaattattcaataaatatgaaaaataa 34138195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 34136197 - 34136255
Alignment:
161 tagcaagtttgactgtagccagttgctcatttcagaaacaccgatcaatctttggttgt 219  Q
    |||||| ||||| || ||||| |  |||||||||||||||| |||||||||||||||||    
34136197 tagcaaatttgattgcagccactcactcatttcagaaacactgatcaatctttggttgt 34136255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University