View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_high_42 (Length: 211)
Name: NF19453_high_42
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_high_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 5313773 - 5313596
Alignment:
| Q |
18 |
ataaaagcataagagctcataaatgtgttcttggtgcacagtcagcagttttagaacgcatgtttgtaatttctgagaagaaaaaggaacaaccaactac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313773 |
ataaaagcataagagctcataaatgtgttcttggtgcatggtcagcagttttagaacgcatgtttgtaatttctgagaagaaaaaggaacaaccaactac |
5313674 |
T |
 |
| Q |
118 |
tataaacataccagacatgtcatttgaagtttgtcaagcattaatcagttatctgtattgaagaagaatttagaaagt |
195 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5313673 |
tataaacatacctgacatgtcatttgaagtttgtcaagcattaatcagttatctgtattgaagaagaatttagaaagt |
5313596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University