View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_low_18 (Length: 322)
Name: NF19453_low_18
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 26 - 304
Target Start/End: Original strand, 40211089 - 40211365
Alignment:
| Q |
26 |
gtagcagcccctacagaaaacaaaaactagctatactttcaaagtctgtagggttaaaaacttgtttgagtggtcctagctgttcagttgtaattctgtt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211089 |
gtagcagcccctacagaaaacaaaaactagctatactttcaaagtctgtagggttaaaaacttgtttgagtggtcctagctgttcagttgtaattctgtt |
40211188 |
T |
|
| Q |
126 |
tcagctttaattcnnnnnnnnnnnnnnnnnnnnnncaaatgcatggcgtcaaaaacaatgttgttgggttgacggtaccttggtgtcgtgtcaatgaaag |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211189 |
tcagctttaattcaaaaaaaataaaaaataaaa--caaatgcatggcgtcaaaaacaatgttgttgggttgacggtaccttggtgtcgtgtcaatgaaag |
40211286 |
T |
|
| Q |
226 |
caatggaggaaagggtggtgttccaaactgtgggttgtgaaataatctcaacataccaaactgctacagagccaaattc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211287 |
caatggaggaaagggtggtgttccaaactgtgggttgtgaaataatctcaacataccaaactgctacagagccaaattc |
40211365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University