View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19453_low_21 (Length: 313)

Name: NF19453_low_21
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19453_low_21
NF19453_low_21
[»] chr5 (2 HSPs)
chr5 (3-140)||(43062205-43062342)
chr5 (232-298)||(43061871-43061937)


Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 3 - 140
Target Start/End: Complemental strand, 43062342 - 43062205
Alignment:
3 gaatcagtgacaaaaaacattggaaatcggaactagattttatgaaaaaacagatcaacatatcaaagcaatatggaaggttgcatgactcctatgatct 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43062342 gaatcagtgacaaaaaacattggaaatcggaactagattttatgaaaaaacagatcaacatatcaaagcaatatggaaggttgcatgactcctatgatct 43062243  T
103 tttgggagctctgataccagtgtgttactacgtatttc 140  Q
    |||||||||||||||||||||||||| |||||||||||    
43062242 tttgggagctctgataccagtgtgttgctacgtatttc 43062205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 232 - 298
Target Start/End: Complemental strand, 43061937 - 43061871
Alignment:
232 tgctctctcaagtcagctcgtgaatgagatcgaaatctaatgaattcacatcaaacaaccaaagaag 298  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
43061937 tgctctctcaagtcagctcgtgaatgagatcgaaatcaaatgaattcacatcaaacaaccaaagaag 43061871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University