View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_low_33 (Length: 249)
Name: NF19453_low_33
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 37994125 - 37994360
Alignment:
| Q |
1 |
ctggtcccctccctgcatcactctcaactctcccaaacctcgctggaatcttcttctatagaaaccagctaaccggagcaataccgaagtcatacggctc |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37994125 |
ctggtcccctccccgcatcactctcaactctacctaacctcgctggaatcttcttctatagaaaccagctaacaggagcaataccgaagtcatacggctc |
37994224 |
T |
 |
| Q |
101 |
attcccgaaatcttttgtagggttggatctgtcgcgaaaccgtctctccgggaagattccagcgtctctggggaagctgaatttgcagattttggacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37994225 |
attcccgaaatcttttgtagggttggatctgtcgcgaaaccgtctctccgggaagattccagcgtctctggggaagctgaatttgcagattttggacttg |
37994324 |
T |
 |
| Q |
201 |
tcatggaacgcgtttaagggtgatgcttcaatgttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37994325 |
tcatggaacgcgtttaagggtgatgcttcaatgttc |
37994360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 50
Target Start/End: Original strand, 37989943 - 37989990
Alignment:
| Q |
3 |
ggtcccctccctgcatcactctcaactctcccaaacctcgctggaatc |
50 |
Q |
| |
|
||||||||||| || |||||||||||| |||||| ||||||||||||| |
|
|
| T |
37989943 |
ggtcccctccccgcttcactctcaactatcccaaccctcgctggaatc |
37989990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University