View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_low_36 (Length: 240)
Name: NF19453_low_36
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 52178560 - 52178770
Alignment:
| Q |
5 |
gtgtaaattagcaaacatgcagattttccattcgactgaaaaattattcatcatacatatcatgaagcaggtatgtatgtagatgttctagccaatataa |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52178560 |
gtgtaaattagcaaacatgcagatttttcattcgactgaaaaatcattcatcatacatatcatgaagccggtatgtatgtagatgttctagccaatataa |
52178659 |
T |
 |
| Q |
105 |
attgtgattaggattctactttgattttctatgagtcctatcagattaagatcaatcatttatttttacttgatgttgctggattagtatgtccacctat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52178660 |
attgtgattaggattctactttgattttctatgagtcctatcagattaagatcaatcatttatttttacttgatgttgctggattagtatgtccacctat |
52178759 |
T |
 |
| Q |
205 |
tgatcgttata |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
52178760 |
tgatcgttata |
52178770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University