View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19453_low_37 (Length: 239)
Name: NF19453_low_37
Description: NF19453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19453_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 121 - 225
Target Start/End: Original strand, 34139108 - 34139211
Alignment:
| Q |
121 |
atgagataaattgcatacatactgcacccagtaattctaatagcaagtttgactgtagccagttgctcatttcagaaacaccgatcaatctttggttgtt |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34139108 |
atgagataaattgcatacataatgcacccagtaattctaata-caaatttgattgtagccagttgctcattttagaaacaccgatcaatctttggttgtt |
34139206 |
T |
 |
| Q |
221 |
tacat |
225 |
Q |
| |
|
||||| |
|
|
| T |
34139207 |
tacat |
34139211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 99
Target Start/End: Original strand, 34138102 - 34138195
Alignment:
| Q |
4 |
agactttgaatacaaaatattgataacttgtcttctttatatttgacctatattaaaaatgagatacataaattattcaataaatatgtaaaataa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
34138102 |
agactttgaatacaaaatattgataacttgtcttctctat--ttgacctatattaaaaatgaaatacataaattattcaataaatatgaaaaataa |
34138195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 34136197 - 34136255
Alignment:
| Q |
161 |
tagcaagtttgactgtagccagttgctcatttcagaaacaccgatcaatctttggttgt |
219 |
Q |
| |
|
|||||| ||||| || ||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
34136197 |
tagcaaatttgattgcagccactcactcatttcagaaacactgatcaatctttggttgt |
34136255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University