View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19454_high_3 (Length: 359)
Name: NF19454_high_3
Description: NF19454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19454_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 125 - 335
Target Start/End: Complemental strand, 34279313 - 34279110
Alignment:
| Q |
125 |
atgaaagatgtgaagattagtgatgatttgagaagttatcttttgtgagactacttgattggtcttatagtgccaaatactttttcttttgggattttgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
34279313 |
atgaaagatgtgaagattagtgatgatttgagaagttatcttttgtgagactacttgattggtcgtatagtgccaaatactttttcttttg-------gt |
34279221 |
T |
 |
| Q |
225 |
tcattgacgctctctctaatggtgatgccaaaggaannnnnnnngaaggaccaaaggaatttgtaatcatgtacatctttgctactttgctatttttgtg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34279220 |
tcattgacgctctctctaatggtgatgccaaaggaattttttttgaaggaccaaaggaatttgtaatcatgtacatctttgctactttgctatttttgtg |
34279121 |
T |
 |
| Q |
325 |
ctttggttgtg |
335 |
Q |
| |
|
||||||||||| |
|
|
| T |
34279120 |
ctttggttgtg |
34279110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University