View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19454_low_11 (Length: 234)

Name: NF19454_low_11
Description: NF19454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19454_low_11
NF19454_low_11
[»] chr5 (1 HSPs)
chr5 (19-174)||(32041715-32041870)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 174
Target Start/End: Complemental strand, 32041870 - 32041715
Alignment:
19 gcagggaatgttcctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32041870 gcagggaatgttcctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaat 32041771  T
119 tggagaaggatgacaggtcttagggcatgtgagtggtagtagctacaaaataagtc 174  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
32041770 tggagaaggatgagaggtcttagggcatgtgagtggtagtagctacaaaataagtc 32041715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University