View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19454_low_11 (Length: 234)
Name: NF19454_low_11
Description: NF19454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19454_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 174
Target Start/End: Complemental strand, 32041870 - 32041715
Alignment:
| Q |
19 |
gcagggaatgttcctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32041870 |
gcagggaatgttcctgaggatttaagcacttcagatatgaatgatctcacatatgtggttgatgagaaaatgaaggaaattaatatgaagatggtgcaat |
32041771 |
T |
 |
| Q |
119 |
tggagaaggatgacaggtcttagggcatgtgagtggtagtagctacaaaataagtc |
174 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32041770 |
tggagaaggatgagaggtcttagggcatgtgagtggtagtagctacaaaataagtc |
32041715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University